Science Room

Show Menu

Questions and answers

Why is using a biologically relevant matrix so important for your research?

Basement membranes (BM) are sheet-like extracellular matrix structures that are the foundation for cells to grow on. The BM composition is highly cell-surface selective and laminins are key proteins. In addition to their central role in BM structural organization, laminin is essential for modulation of vital cellular responses, such as cell adhesion, differentiation, migration, phenotype stability, and resistance to apoptosis. Without the right combination of laminin isoforms, cells and tissues become dysfunctional.

Biorelevance is about emphasizing nature. Our laminin cell culture matrices allow you to imitate the natural, cell-specific cell-matrix interaction in vitro, leading to enhanced cell maturation, cell organization, and improved cell functionality. We offer an expansive portfolio of chemically defined and animal origin-free laminin proteins for a variety of applications, including the reliable expansion of pluripotent cell and differentiation and maintenance of specialized cell types, such as hepatocytes, skeletal muscle cells, and different neural cells. The impact of our laminin matrices on cell culture quality has been scientifically validated in many high-impact journals. 

What are the major advantages of using human recombinant laminins vs. truncated or tissue-originated laminin products?

Our Biolaminin cell culture matrices are the only original full length, recombinant laminins on the market, with all the functional domains intact. Laminins isolated from the tissue is an impure mix of several ECM proteins. Moreover, during isolation, the proteins tend to be heavily degraded with the consequence of structural integrity and lost function. A fractionated or truncated laminin molecule or laminins isolated from tissue lack many of the laminin domains which is needed by the cells for the proper extracellular network to form and to for stimulation of correct cellular signal transductions. Hence, only the intact, full-length laminin can create a more authentic cell culture environment.

For reference about the difference in quality and function of commercially available recombinant versus isolated preparations of laminins see Wondimu et al., 2006.

What is the purity of your Biolaminin products?

The purity of our laminin products is greater than 95%, as assessed by SDS-PAGE. The laminin protein size is confirmed under the reduced and unreduced conditions and verified equivalently with both methods. 

Do the recombinant laminins have any purification tag?

The alpha4 and alpha5 chain of our Biolaminin products has a FLAG-tag at the N-terminal end. Alpha2 chain of LN211 has a HA-tag at N-terminal end and a FLAG-tag at the C-terminal end. 
 

Which antibodies do you recommend for recognizing different laminin chains in a tissue?

As a tool to identify and study the expression pattern of different laminin subunits present in a specific tissue we recommend using the Laminin Marker Panel of PrecisA Monoclonals from Atlas Antibodies.

Can you provide the laminin chain primers?
Laminin chain
Gene
GenBank accession no.
 
5’-primer
3’-primer
Amplicon size (bp)
Annealing temp (°C)
α1
LAMA1
NM_005559
GTCAGCGACTCAGAGTGTTTG
AACTTGGGTGAAAGATCGTCAG
185
55
α2
LAMA2
NM_000426
GAACCCGCAGTGTCGAATCT
GGGGAGTTAGCTGCCTTCA
204
55
α3
LAMA3
NM_000227
TAGACTTTGGAAGCACCTACTCA
GTTTATCAAGGACACCACAACCT
185
55
α4
LAMA4
NM_002290
GCAGTGGAAATTCAGATCCCA
TAACCGCAGGTCATCAGTCAG
275
55
α5
LAMA5
NM_005560
GGTGTGTCTCTGCGTGACAA
CCCCGACGTAGAAGACGAA
253
55
β1
LAMB1
NM_002291
AGGAACCCGAGTTCAGCTAC
CACGTCGAGGTCACCGAAA
103
55
β2
LAMB2
NM_002292
GCCCTGGGAACTTCGACTG
GGAAGCACTTCTTTTCGTCCTG
227
55
β3
LAMB3
NM_000228
TCCTCTTGTGTTTTGCCCTG
CTGCCTGGAGTCACACTTG
206
55
γ1
LAMC1
NM_002293
TCGTCAACGCCGCCTTCAA
TACAACAACCAGGCCGACAC
184
55
γ2
LAMC2
NM_005562
CCAGGAGGGAAGTCTGTGATT
GCAGTGAATCCCATCAGTGTT
128
55
γ3
LAMC3
NM_006059
CCAGGTGCATCACATCCTCA
GAC CCCATTTGGGCTCCATT
106
55
γ3 alternative primer pair: 5’-primer: TGACTGGCTGGAAGTGTGAC, 3’-primer: TTGCCTTCCACATTCTCTTT (product size:151 bp)

 

What are the molecular weights of the different laminin isoforms?Biolaminin molecular weights

The molecular weights (MWs) of the different laminins isoforms are stated in the table. Due to the complex post-translational modifications such as glycosylation of the laminin molecules, the MWs of each laminin is deduced by amino acid sequences used as a reference.

 
Does your Biolaminin 332 product contain the LG4 and LG5 domains of the alpha chain?

The LN332 trimeric protein has ~628 kDa total molecular weight (non-reducing SDS-PAGE) and represented by three individual bands (~367 kDa, 130 kDa, 131 kDa) in reducing SDS-PAGE. We can only be sure that full-length DNA was transfected but since the protein is naturally expressed, we can not be sure whether these two domains are cleaved away or not during protein maturation. Our Biolaminin 332 supports better cell attachment and growth and is thus proved functional. 


What is the amino acid sequence of the different alpha, beta, gamma chains och the laminin molecules?
   

Protein Seq

aa. Number

Alpha chain

A1

P25391

3075

 

A2

P24043

3122

 

A3

Q16787

3333

 

A4

Q16363

1823

 

A5

O15230

3695

       

Beta chain

B1

P07942

1786

 

B2

P55268

1798

 

B3

Q13751

1172

       

Gamma chain

C1

P11047

1609

 

C2

Q13753

1193

 

 

 

How do laminin proteins interact with each other and how do they attach to the cell culture well surface?Biolaminins pI and Net charge

In vivo, basement membrane composition is highly cell-surface selective and for proper assembly, laminins are the key proteins. Laminin molecules self-assemble via a thermodynamically unfavorable nucleation binding followed by a calcium-dependent polymerization of the LN domains in the short-arms of the α, β, and γ chains (Yurchenco et al., 1985; Carafoli et al., 2012; Yurchenco & Cheng, 1993; Purvis & Hohenester, 2012). The sheet-like laminin network binds to other proteins in the basement membrane. Laminin interacts with nidogen via LE motifs of the γ1 and γ3 chains (Gersdorff et al., 2005; Takagi et al., 2003; Stetefeld et al., 1996), and the Lβ domain of the β chains binds to agrin (Domogatskaya et al., 2012). Laminin is linked to collagen IV through nidogen and heparin interactions, forming a covalently stabilized network (Hohenester & Yurchenco, 2013). 

Laminins are large proteins with both hydrophobic and hydrophilic sites that allow them to interact with artificial surfaces. The highest density of anionic (negative) charges in laminins is to be found in the LG modules. It has been suggested that the density of negative charges on the surface could be critical for laminin-binding and self-assembly. Tissue-culture treated is a process by which polystyrene surfaces are made to become hydrophilic, usually by increasing negative charge through a chemical means. This increased negative charge is important for cell attachment and may explain why cells cultured in non-treated plastic ware clump up since they are not attaching adequately to the surface. 

The net charge and isoelectric pH (pI) of the Biolaminin proteins are displayed in the table.

 

What is the extinction coefficient (absorption) for the different laminin isoforms?

Laminin extinction coefficient

How do I store the laminin protein properly?

The Biolaminin stock solution has long-term stability when stored at -20°C to -80°C. Please refer to the product-specific CoA. Repeated freeze/thaw should be avoided. For your convenience, you can aliquot the Biolaminin stock solution to smaller aliquots and store at -80°C. 

Thawed Biolaminin stock is stable for at least 3 months when stored at +2°C to +8°C under aseptic conditions. Avoid long exposure of the protein to ambient temperatures. Laminin coated plates are recommended to be used as fresh as possible but, for your convenience, coated plates and diluted coating solution can be kept at 2-8°C for up to 4 weeks. Seal the plates (e.g. with Parafilm®) to prevent evaporation. The Biolaminin matrix will be inactivated if let dry.  

How many freeze-thaw cycles your laminin 521 LN can go through? 

Our data show that LN521 can go through 3 freeze-thaw cycles without losing functionality. 

How long can I store the thawed laminin stock solution?

Thawed Biolaminin stock solution (100 ug/mL) is stable for at least 3 months when stored at +2°C to +8°C under aseptic conditions. 
 

How long can I store laminin-coated plates?

Biolaminin coated plates are recommended to be used as fresh as possible but, for your convenience, coated plates and diluted coating solution can be kept at 2-8°C for up to 4 weeks. Seal the cultureware (e.g. with Parafilm®) to prevent evaporation and contamination. TheBiolaminin matrix will be inactivated if let dry. Adjust the volume by adding DPBS (Ca++/Mg++).

Unused wells from coated plates stored at 37°C are not recommended to be re-used.

How stable are the Biolaminin substrates at room temperature?

The proteins should be handled with care and unnecessary exposure of the protein to ambient temperatures should be avoided. If possible, keep the sample on ice during work.

How do I use Biolaminin for cell culture?

Coat cultureware with Biolaminin solution according to the instruction. Dilute the thawed laminin stock solution with 1xDPBS (Ca++/Mg++) and add the diluted Biolaminin solution to tissue culture-treated cultureware. Seal the cultureware (e.g. with Parafilm®) to avoid evaporation. Incubate at +2°C to +8°C overnight or, if a more rapid coating is required, incubate at +37°C for 2 hours. For the culture of cells, suck away the excess laminin coating solution and add the cell suspension to the laminin-coated well. No washing is required. If not used immediately, coated plates and diluted coating solution can be kept at +2°C to +8°C for up to 4 weeks. Do not allow the coated surface to dehydrate as that will inactivate the laminin coating.

What is the recommended Biolaminin coating concentration?

For the culture of hESC or iPSC lines, 10 ug/mL Biolaminin 521 is recommended as a starting concentration. Once the cells have been adapted to the Biolaminin 521 coating, the coating concentration generally can be lowered to 5 ug/mL. The optimal coating concentration is cell type-dependent and should be optimized empirically for specific isoforms and cell lines. For many MSC lines and for many neural applications, a coating concentration as low as 1 ug/mL often can be used. For the culture of some specialized cells, such as cardiomyocytes, a higher coating concentration (10 ug/mL) might be required. A too low coating concentration could result in slow growth or an uneven cell spread.

What is the rationale behind the need to use tissue culture-treated plates with laminin-coating?

Tissue culture (TC) plates are treated in a way that the surface negative charge is increased so that they are more hydrophilic, which is important for cell attachment. We have tested Biolaminin coating on a non-TC plate and it works but cell morphology is different with more tight colonies which might be due to less attainment area per cell). We recommend using TC plates for our Biolaminin products.

Does the coating concentration affect the properties of the cells?

A too low coating concentration will result in slow growth and an uneven cell spread. Otherwise, no significant impact on cell properties has been observed.

Is it possible to measure the coating efficiency of the laminins?

In-house we only use cell attachment to estimate coating optimization (not a quantitative method). By seeding the same numbers of cells on the plate that is coated with different amounts of laminin and read the cell confluence next day post-seeding, we can see the optimized coating concentration of the tested cell line. When most cells attach and when the monitored confluence (%) do not increase along with the increased coating concentration the optimal coating concentration has been reached. The optimized coating concentration can be different from cell line to cell lines, and we generally recommend using 10 ug/ml as a starting concentration, decreasing the coating concentration to 5 ug/ml once the cells have adapted to the laminin culture conditions.

Another method would be ELISA. A customer of ours has tested an ELISA method where they coated the plate with different amounts of laminin and used an antibody (Abcam ab11575 (Rabbit polyclonal against mouse EHS)) to detect and measure the laminin protein. This antibody recognizes different kinds of laminin chains and could be commonly used for this purpose. However, if more than one type of laminin is used for coating there are monoclonal antibodies to each laminin chain available from Atlas antibodies. 

Is there a difference in performance between the slow coating and the fast coating?

No significant difference in cell survival and proliferation rate has been observed.

Is it possible to use laminins with the diluted in the medium for culturing cells?

For pluripotent cell culture and also differentiation applications, the Biolaminin matrix should be diluted in DPBS for coating. proteins in the medium could affect the coating efficiency. 

Are BioLamina's laminin proteins optimized for any specific plastic brand?

The laminin coating is not optimized for certain plastic brands or well formats, however out of the brands tested there are a few with which the laminin coating seems to be functioning better (e.g. Falcon, Sarstedt, Corning) than others. Some Nunc culturewares are not compatible with laminin coating. 

Can the laminin be used to coat other surfaces, such as glass?

Yes, laminin can be used for coating glass with good cell attachment and maintained cell functions. Coat glassware as you normally coat your cultureware, however, 24-48 hours coating at +2°C to +8°C is recommended for a more reliable coating. Seal the coated glassware to avoid evaporation. Make sure all the surface is completely covered by the laminin coating solution as an uncoated surface will not support cell growth. Please see Miyanari et al., 2013 for coating reference. 

Can I re-use the coating solution?

Due to contamination risks and uncontrollable coating concentration issues we do not recommend re-using the coating solution but rather to evaluate the optimal coating concentration for your cells and application by titration. Often a lower concentration than the recommended starting concentration could be used. For the culture of Biolaminin 521 adapted hESC or iPSC lines, a coating concentration of 5 ug/mL often works well. For many MSC lines and for many neural applications, a coating concentration as low as 1 ug/mL often can be used. Note that the optimal coating concentration is cell type-dependent and should be optimized empirically for specific isoforms and cell lines.

How long does the laminin coating last in culture? Do I have to add extra laminin to long-term cultures?

The Biolaminin coating is functional for at least one month in culture. For long-term culture, if cell detachment is noticed, we recommend adding 1-5 ug/mL extra laminin to the medium.

Can I mix the laminins with other matrix proteins, such as collagen?

We don't have any data for this, but to ensure the best coating, one should do a titration to optimize the mix ratio and coating time. 

Is it possible to increase the concentration of laminins for coating and reducing the time of coating from 2 h to 1 h instead (37°C)?

We usually don’t recommend customers to carry out the coating in less than 2h incubation at 37°C. There is a risk that the coating may not be enough for cell attachment and survival. By increasing the coating concentration above that you usually use could have an effect but the variation that could be caused by this change should be taken into account.

I have issues with bad cell attachment when transferring my pluripotent stem cells from feeder cells or from feeder-free culture substrates to laminin. What can I do?

If the transfer from other culture substrates is problematic, please follow the instruction for transfer to laminin. Some fay aspects are listed here:

  • We recommend transferring the cells as single cells (or as small clumps) and always with the addition of apoptosis inhibitor, such as ROCKi for the first few (3-5) passages. Once the cells are adapted to the Biolaminin 521 matrix, the cells can be cultured as single cells without ROCKi. This may take up to 5 passages - give it some time.
  • If the cells are hard to adapt, try increasing the coating concentration to 10 ug/ml and seed at a higher cell density 50 000–100 000 cells/cm2. Once the cells are adapted a lower coating and seeding concentration often can be used.
  • It is important that the cells transferred to the Biolaminin 521 matrix are of high quality. Biolaminin 521 also supports specialized cell types so carefully select only undifferentiated cell areas for transfer. 
  • Biolaminin 521 works well in combination with most commercial media brands. However, it is to be expected that cell morphology will look different depending on the medium used for culture. 

After seeding, I experience an uneven cell spread: What could be the reason for that?

An uneven cell spread is often caused by an insufficient coating and could be caused by the following:

  • A too low coating concentration is being used. Increase the coating concentration until you reach a high enough to support even cell growth.
  • DPBS Ca--/Mg-- have been used to dilute the laminin stock solution. We recommend using DPBS with Ca2+ and Mg2+ since divalent cations are important for the protein structure and function. 
  • Issues with the cultureware plastic. Most plastics work well for laminin coating but we know the laminin coating is not compatible with some NUNC-plates. SARSDET and Corning plate usually work well.
  • Bad coating coverage/the plate has dried out. Ensure that the entire surface is covered by the laminin coating solution when preparing fresh plates. Also, do not let the plate dry out as this will inactivate the laminin coating. Too long time in the incubator or long storage without sealing could cause too much evaporation so that part of the plate dries out (often center).
Can I culture pluripotent stem cells as single cells on Biolaminin 521 without the use of apoptosis inhibitors? 

Yes! Biolaminin 521 successfully recreates the biologically relevant hPSC milieu in vitro and via integrin binding, Biolaminin 521 induces the PI3K/Akt signaling pathway, promoting high survival and robust long-term self-renewal of human embryonic stem cells (hESC) and induced pluripotent stem cells (iPSC). Due to the biologically relevant support from the laminin matrix, pluripotent stem cells can be cultured as single cells without the need for apoptosis inhibitors, such as ROCKi. When transferred from feeder-cells or feeder-free substrates to laminin, the cells might need an adaptation period. It might take up to 5 passages so give it some time. Once the cells are adapted to the Biolaminin 521 matrix, the cells can be cultured as single cells without ROCKi.

Which enzymes do you recommend for passaging PSCs growing on laminin?

You can use a dissociation reagent of choice (e.g. TrypLE select, Trypsin-EDTA, EDTA, Accutase). The incubation time depends on the solution used to dissociate the cells and the specific cell line. Please note that cells often attach tighter on laminin compared to other matrices and scraping or pipetting without first loose up cells can affect cell integrity and viability which could result in less attachment the next day. Less confluent cells need shorter treatment time whereas more confluent cells might need longer treatment time. The cells should detach easily without too much pipetting needed. Stem cells are sensitive and too long exposure to dissociation enzymes or too much mechanical force applied may result in lower cell viability. 

Does the Biolaminin 521 substrate only work with a specific hPSC media?

The robust support of pluripotent stem cells by the Biolaminin 521 culture substrate allows you to work with your medium and enzyme of choice. As a result, your protocols can easily be made totally defined and animal origin-free. We have successfully tested many different commercial media, such as NutriStem™, mTeSR™1 & TeSR™2, and Essential 8™. However, it is to be expected that cell morphology will look different depending on the medium used for culture.  

If you are using AF Nutristem XF for feeder containing culture, remember to switch to NutriStem XF/FF when using Biolaminin 521 as a coating material.

How long does the laminin coating last in culture? Do I have to add extra laminin to long-term cultures?

Yes, many of our customers use the Biolaminin matrix for long-term culture protocols (several months). The Biolaminin coating is functional for at least one month in culture. For long-term culture, if cell detachment is noticed, we recommend adding 5 ug/mL extra laminin to the medium (spiking the medium) to improve attachment.

Can I passage my stem cells as colonies using the stem cell matrix?

Yes, Biolaminin 521 supports both single cell and colony passaging. However, we recommend single-cell passage or passage as small clumps since it is a much easier and more reliable method that allows standardized cultures. Each cell will have equal contact with the coating and the medium resulting in a homogenous environment. Biolaminin 521 is the natural niche protein for the cells and enables cell-cell contact since it promotes high cell migration. The survival rate after single-cell seeding is high. When using Biolaminin 521 no treatment with apoptosis inhibitors, such as Rho-kinase (ROCK) inhibitor or blebbistatin, is needed to prevent anoikis. Hence, the conventional method where the colony state is maintained to prevent apoptosis after re-seeding is unnecessary. Single cell passaging also decreases the risk of spontaneous differentiation.

Which range of seeding density do you recommend for human pluripotent stem cells?

Optimal seeding densities will vary from one cell line to another and should be determined empirically for your system. Laminin-521 has been shown to support cell survival of as low as 5,000 cells/cm2. However, we generally recommend seeding your cells at a concentration of 30 000-50 000 cells/cm2 or split your cells with a ratio of 1:10 to 1:30. 

How long does it take for the seeded cells to attach to the laminin matrix?

Most cells should have attached within 1-hour post-seeding and the cells should be evenly distributed over the entire plate. If there is a lot of cell death after seeding, the cells have most likely been treated too harshly during splitting. After cell attachment, the cell starts to migrate and should have formed small colonies 24h post-seeding. The cells will continue to expand as a homogenous monolayer and are ready to be passaged when cell culture is 60-99% confluent. Depending on the cell line, seeding density, and on the medium used, cultures are usually passaged 3-6 days after seeding.

Can I make clonal cultures on Biolaminin 521?

Clonal cultures can efficiently be done with the Biolaminin 521 under defined and animal origin-free conditions. Biolaminin 521 even allows hESC derivation from a single blastomere without the need to destroy the embryo. The science behind this is further described in an article in Nature Communications by Rodin and colleagues (Rodin et al., 2014).

Why do I see that cells stick to the outer rim of the wells in 96-well plates?

This is probably caused by the high surface tension created in the smaller well formats. Try to slightly increase the coating volume. 

Do I need to pre-warm all solutions before usage and why?

The solutions should be pre-warmed since a large variation in temperature is stressful for the cells.

Can I use BioLamina’s human recombinant laminins for my animal ES and iPS cells?

Yes, most likely. Laminins, as well as many other basal membrane proteins, are highly conserved proteins. Customers working with mouse, sheep, rabbit, and monkey stem cells are successfully using our human recombinant laminins.
 

When culturing my mESC feeder-free on Biolaminin 511 or Biolaminin 521, do I have to add LIF to prevent the cells from differentiating?

No, Biolaminin 511 and 521 supports self-renewal of mouse ES cells in the absence of feeder cells, LIF, or other differentiation inhibitors, even at low cell density. Both laminin isoforms successfully support both naive and primed stem cells since it has been shown to activate the PI3/Akt pathway while the MAPK/ERK pathway is unaffected (Rodin et al., 2014).
 

When using Biolaminin 521 to culture human ESCs, I have an issue with uneven cell distribution. The cells don’t attach to some areas of the well, whereas they attach and grow normally in other areas. What can I do to solve this issue?

The problem could be caused by the following:

  1. That the coating concentration used is too low for your specific cell line. Try to increase it to 10 ug/ml. Once the cells are adapted to the Biolaminin 521 matrix, you can try to reduce the coating concentration to 5 ug/mL.
  2. That the coating volume used is not enough. This is often a problem seen with smaller well sizes due to surface tension. For 24-well plates, 500uL of coating solution per well should be enough for even coverage. For a 6-well plate, at least 1ml should be used. 
  3. That the coating solution has dried out before cell seeding. If the coating matrix goes dry, this will inactivate to coating and it will not support cell growth. This could happen when not enough coating solution have been used or if the time during the exchange of the coating solution to the culture medium was prolonged. Make sure to seal the plate during overnight coating in the fridge. If a quick coating at 37 degrees is used, do not leave the plate for more than 3 hours to prevent it from drying out.
  4. That the cells were not seeded evenly in the seeding step. Make sure that you rock the plate side-to-side after seeding to get an even cell spread.
  5. That a non-tissue culture plate has been used. Make sure to use a tissue culture plate. There could also be issues with the cultureware plastic. Most plastics work well for laminin coating but we know the laminin coating is not compatible with some NUNC-plates. SARSDET and Corning plate usually work well. 
How do I transfer my cells from feeder cells to the Biolaminin 521 culture substrate?

We recommend transferring the cells as single cells (or as small clumps) and always with the addition of ROCKi for the first few (3-5) passages. Once the cells are adapted to the Biolaminin 521 matrix, the cells can be cultured as single cells without ROCKi. This may take up to 5 passages. If the cells are hard to adapt, use a higher coating concentration (10ug/ml for LN521 or 20ug/ml for MX521 and CT521) and seed at a higher cell density 50 000–100 000 cells/cm2. Once the cells are adapted a lower coating and seeding concentration often can be used.

It is important that the cells transferred to the Biolaminin 521 matrix are of high quality. Biolaminin 521 will generally also support differentiated cells so carefully select only undifferentiated cell areas for transfer. 

When changing from feeders, the cells might display a different morphology for the first few passages, likely due to the packed monolayer the cells form when confluent, rather than thick colonies as seen on feeders. It is important that the cells are of high quality when being transferred from feeders to the Biolaminin 521 substrate. Biolaminin 521 supports the maintenance of pluripotent cells but may also support some differentiated cells. Therefore, it is important that only undifferentiated cell colonies are being transferred

Can cells, which have been growing feeder-free substrates, such as Matrigel, be directly transferred onto Laminin? Will cells look the same after transfer?

When moving your cells to Biolaminin 521 from another feeder-free matrix (i.e. Matrigel or vitronectin), generally no specific adaptation is needed. We recommend transferring the cells as single cells (or as small clumps) and always with the addition of ROCKi for the first few (3-5) passages. If the cells are hard to adapt, use a higher coating concentration (10ug/ml for LN521 or 20ug/ml for MX521 and CT521) and seed at a higher cell density 50 000–100 000 cells/cm2. Once the cells are adapted a lower coating and seeding concentration often can be used.

It is important that the cells transferred to the Biolaminin 521 matrix are of high quality. Biolaminin 521 supports the maintenance of pluripotent cells but may also support some differentiated cells. Therefore, it is important that only undifferentiated cell colonies are being transferred.

Cell morphology should not change much, however, you should be prepared for a different growth pattern. Biolaminin 521 promotes high migration which is vital for cell survival. That will render a more even spread of the cells as compared to feeders and other feeder-free matrices. Also, the cells will likely grow faster.

An adaptation stage may be required when moving from other matrices to MX521. Do you expect this to be the same when moving from normal laminin521 to MX521?

Yes, the change from LN521 to MX521 might need a few passages adaptation. One should also be aware the cell morphology may change where cells on MX521 will look more flatten and bigger compare to using LN521. This is nothing to be concerned about. The expression of stemness markers between the two culture systems does not differ. When cells amplify near confluent, cells will become smaller and show the typical cobblestone shape. 

 

When thawing hPSCs grown on the laminin, what is the recovery like?

The post-thaw cell survival is high when supported by Biolaminin 521, especially when frozen and thawed as single cells. This is nicely described in a recent publication by Miyazaki and colleagues, where they show that hPSC that were frozen and thawed as colonies showed markedly decreased survival compared to cells frozen and thawed as single cells where the majority of the cells were viable (Miyazaki et al., 2013).

What is Biosilk?

Biosilk is a humanized biomaterial made from recombinant silk protein. Biosilk 521 has been functionalized with recombinant Biolaminin 521. The Biosilk products can be processed into a variety of two- and three-dimensional formats and integrate into biological systems with excellent biocompatibility.

What is the difference between Biosilk and Biosilk 521?

Biosilk 521 is Biosilk functionalized with Biolaminin 521. Biolaminin 521 (hr laminin 521) is a key cell adhesion protein of the natural stem cell niche, providing the Biosilk 521 material with unique, functional properties that are ideal for integration, proliferation and subsequent lineage-specific differentiation of human pluripotent stem cells in a 3D format. 

Which is the concentration of Biolaminin 521 within Biosilk 521? What is the Ratio?

Biosilk 521 has a Biolaminin 521 concentration of 9ug/mL (ratio 10:1 Biosilk and Biolaminin 521).

Can I mix the Biosilk product with another Biolaminin isoform than Biolaminin 521?

Yes, you can mix Biosilk with any Biolaminin product. Add 25 μL of the Biolaminin product of choice to he thawed Biosilk solution (250 μL). Mix by gently pipetting 3 times without introducing air bubbles. The final mixture will have a concentration of 10 ug/mL Biolaminin.

When should I use Biosilk 521? What biological effect does Biolaminin 521 have on the cells? 

Biolaminin 521 (Laminin 521 protein) is a key cell adhesion protein of the natural stem cell niche, expressed and secreted by hPSCs in the inner cell mass of the embryo. The Biolaminin 521 cell culture substrates successfully recreate the biologically relevant hPSC milieu in vitro. Via integrin binding, Biolaminin 521 induces the PI3K/Akt signaling pathway, promoting high survival and robust long-term self-renewal of human embryonic stem cells (hESC) and induced pluripotent stem cells (iPSC). Biolaminin 521 supports high survival of cells as single cells even without the addition of ROCKi and also promotes migration with facilitates cell organization in the Biosilk scaffold. Together, Biosilk and Biolaminin 521 create a biologically relevant 3D culture environment for the expansion and differentiation of human ES and iPS cells. The laminin 521 protein is also one of the most common laminins expressed in the human adult body and therefore Biolaminin 521 also supports the culture of specialized tissue cell types, such as pancreatic cells, liver cells, vascular cells, cardiac and skeletal muscle cells, and different neural cells.
 

Do the cells sit on top of the silk?

Contrary to many other 3D scaffolds where the cells are seeded onto an already formed 3D network, cells can be mixed in the Biosilk solution prior to the silk network formation. That means that the newly formed silk fibers will encapsulate the cells and the cells will be evenly distributed throughout the 3D matrix. As a result of the air bubbles present during the formation, this 3D structure will also be porous, allowing for much larger contact with nutrients and oxygen in the media.

Can I use Biosilk to generate organoid cultures?

Yes! It's an excellent 3D culture system for organoid culture. Seed pluripotent stem cells (or another cell type of interest) in Biosilk-Biolaminin foam attached to the bottom of a cell culture well. Amplify the hPSCs to the desired confluency before switching to a differentiation medium of choice. When cells have reached the desired confluency within the microfibrillar network, manually detach the foam from the bottom of the well using a cell scraper or a pipette tip. Cut the foam structure into 2 -4 pieces (approx. 2 mm thick) using a blade or a pair of small scissors and transfer to new low-attachment culture plates for culture as free-floating entities.

Are the Biosilk products a gel?

No, the Biosilk products are a spider silk-based biomaterial that can be formed into different 3D structures. It is more a fibrous network than a gel.
  

Can I mix the Biosilk products into a hydrogel? 

It is possible to add a hydrogel to the Biosilk products after assembly (e.g. after generating a foam). However, embedding the organoid in Matrigel is not needed to maintain the organoid shape and cell phenotype. If embedding is preferred, a xenofree and defined material is recommended (e.g. HyStem™ available from Merck).

What is the difference between culturing cells in Biosilk compared to a hydrogel?

There are big differences in the spreading and expansion of cells within Biosilk compared to when encapsulating cells in a hydrogel. Biosilk provides a more tissue-like environment that promotes the formation of focal adhesion points that trigger the organization of the cytoskeleton. In a scientific publication from 2019, the authors compared Biosilk to an Alginate hydrogel coupled with the cell-binding motif RGD (0.01-0.04 μmole/mg). Mammalian cells cultured in Biosilk and alginate showed markedly different growth curves. A clear expansion phase was seen for cells integrated into Biosilk, while cells encapsulated in alginate remained at an almost steady metabolic state, an observation is in line with previous reports of the limited proliferation of cells encapsulated in alginate hydrogels. Cells cultured in Biosilk had a more elongated shape (a sign of attachment) and increasingly spread out within the silk scaffold with a clear directional alignment in the fibers. Contrary, cells encapsulated within the hydrogel exhibited a rounded morphology and no spreading was observed (static encapsulation in the hydrogel). In the Biosilk cultures, punctate vinculin-rich focal adhesions sequestered to the tips of cell protrusions were observed, confirming integrin-involved binding of cells to the Biosilk. In the hydrogel, the coupled RGD-motif is available for integrin binding, but the very thin alginate chains (one saccharide unit thick) do not physically allow the gathering of several integrins to the same spot. That prohibits the formation of focal adhesion points which explain the rounded morphology of cells within the alginate gels.
 

Is it possible to functionalize Biosilk with other proteins other than laminin? 

Yes, most proteins will have a tendency to get entrapped/entangled in the Biosilk.

How long does it take the cells to degrade the silk molecules?

Somewhere between 1 to 6 months.

Are the Biosilk products defined and animal origin-free?

The Biosilk products are defined and animal origin-free to the primary level (Ref: ISCT guidance document “ISCT Animal-Free Origin Survey Results-Summary).

Have you measured the stiffness of the Biosilk? At the minimal cell to Biosilk ratio, what is the stiffness? 

Biosilk with integrated mesenchymal stem cells has a Youngs modulus 1.8 +/− 0.5 MPa with 25% elongation.
 

Do you have protocols for other creating sheets or films of Biosilk rather than foams? 

Sheets of Biosilk can be formed by placing a solution of 1 mg/ml still during 8 h (unpublished data).
Films/coatings of Biosilk can be formed by incubating a solution of 0.1-0.3 mg/ml on the preferred surface (e.g. plastic, glass, metal) for 30-60 min and then wash (see scientific article).

Is it possible to make different layers of Biosilk foam on top of each other? 

Yes, but the first foam generated needs to be stabilized at least 20 min before adding the next layer.
 

Does the Biosilk have some kind of autofluorescence?

Yes, you can expect some autofluorescence, at lower wavelengths, but it is not worse compared to tissue. A couple of collaborators have done calcium imaging with Fluo-4, and it worked really well (published in this scientific article). The best is if you can use fluorophores over 350 nm.

Can I do immunocytochemistry of the cells in Biosilk?

Yes! Fix the silk/cell construct in 4% paraformaldehyde, embed them (eg. Tissue-Tek), and section (eg. using a Leica cryostat). The procedure is published in this scientific article. Be careful not to let the silk dry (same as with tissue and cells).

Can you extract cells from the Biosilk foam, without any residual spider silk being present in the final cell suspension? 

Yes, it is possible to enzymatically release (e.g. trypsin, Accutase) cells from the silk form of Biosilk. In the silk form, Biosilk is very stable against proteases.

Would Biosilk only be applicable for soft tissue organoid models? What about bone models? 

It is possible to integrate Biosilk into ceramic material and during biomimetic mineralization of calcium phosphate (see upcoming article).

What is the mechanism behind the foam formation? Why should bubbles be generated that then should burst? 

The air/liquid interface makes the foam stabilize, forming a fibril network around the cells. The air bubbles are not natural in vivo, and the foaming step is just to form the 3D network and the bubbles should disappear. The smaller bubbles merge into bigger bubbles that should burst after 3 to 4 days. However, mechanical interruption (like puncture) is not recommended. After the bubbles have disappeared, the foam may look flat but it's actually a3D structure with several layers. The network support cell growth in a 3D environment surrounded with nutrition from all dimension. 

Why does the foam spontaneously detach the day after seeding or when I add the medium?

There are many things that affect bad foam attachment or poor foam stability:

1. The surface for foam generation is not hydrophobic enough. Not all kinds of suspension culture plates work well. We recommend using the plates from SARSTEDT ref:83.3922.500

2. The generated foam diameter is too small. If the area size of the foam is too small, that will result in a bigger lifting force once the medium is added. The foam size should be 0.7-1 cm in diameter for good attachment.

3. The silk solution has been standing at room temperature too long after thawing. The silk solution should be used directly after thawing (within 1 h). If the solution looks milky, do NOT spin/centrifuge the Biosilk solution as that will damage the product. 

4. The stabilization temperature has been lower than 37C. Try only using the outer wells of the plate so that the stabilization temperature reaches 37°C faster. Alternatively, the stabilization time was not long enough (less than 20 min). Prolong the incubation time to 25 min.

5. After stabilization, carefully drop medium both on the foam and around it, before slowly covering the foam with the medium. Filling up medium around the foam only will generate a lifting force to the foam. Do not add the medium too fast as that may break the foam apart.

Why does the foam break into pieces (disperse) when I add the medium?

There could be due to one of the following several reasons:

1. The silk solution has been standing at room temperature too long after thawing. The silk solution should be used directly after thawing (within 1 h). If the solution looks milky, do NOT spin/centrifuge the Biosilk solution as that will damage the product. 

2. The foam is not pipetted well enough. A soggy foam is more difficult to stabilize. Make sure to pipet 22-25 times with rapid speed while spreading the foam to a diameter of 0.7-1.0 cm with circular motions. However, do not over-pipet (more than 25 times) since that could result in a break down the 3D structure formed. Avoid generating too large bubbles because it will give a less fibril structure. During foam formation, try to generate small and evenly distributed bubbles.

3. The ratio of the total added Biolaminin + cell suspension volume to the Biosilk volume used has been higher than 1/5. If the ratio is exceeded, the Biosilk will be too diluted to be able to generate a stable scaffold. If the cells will be mixed in after the foam has been generated, do not use more than 4µL of the cell suspension to 20 µL of Biosilk or Biosilk 521 solution. If another Biolaminin isoform will be added to the Biosilk, the total added Biolaminin volume should not exceed 1/10 of the Biosilk volume.

4. The stabilization temperature has been lower than 37°C. Try only using the outer wells of the plate so that the stabilization temperature reaches 37°C faster. Alternatively, the stabilization time was not long enough (less than 20 min). Prolong the incubation time to 25 min.

5. When adding the medium to the stabilized foam, carefully drop medium both on top of the foam and around it. Adding medium only around the foam will have a lifting force to the foam.

Can I use a 96-well format?

Our current protocol is designed for 24-well plates. A smaller well format is more difficult to work with because it's hard to monitor the foam formation. If another well size is preferred, make sure that the surface is hydrophobic.
 

Is it OK if the Biosilk doesn’t sit in the middle of the well but touching the cell culture wall?

No, the foam should not touch the wall of the well. The foam will form in the wrong way.

How many foams will I get from a Biosilk vial?

One vial is enough for 12-13 well of a 24-wells plate. 

What is the smallest volume I can use and still get a good foam?

The smallest volume to foam up properly is 4-5ul. Cell suspension volume radio to silk should exceed 0.25, or the silk will get too diluted and hard to stabilize. For 4-5 ul silk, a maximum of 1ul cells can be added to the silk. For scale-up, the foam can be cut into smaller pieces of the desired size after the cells have been amplified.

The 3D foam does not shape properly. It looks flat. What could be the reason?

Make sure a hydrophobic culture plate is being used (e.g. Sarstedt 83.3922.500). If the plate is not hydrophobic, the Biosilk solution will be difficult to pipette and the foam will become flat.
 

Can I use Biosilk 521 to generate organoid cultures?

Of course! After seeding and amplification, the cell/foam structure can be detached/lifted off the well to a floating culture for differentiation.

How do I place an order?

Visit our shop and create an account. Just add the products of interest to the shopping cart and proceed to checkout. You can also send e-mail to orders@biolamina.com.

Do you have distributors?

We have distributors in selected regions. Please see our distributor list. We ship directly to all other countries.